Messiah is the floodlight that lights up our life. As you exhale, imagine that you are releasing any tension or stress in your body. in mammals contains from so few genes? His son is the path of deliverance. Tech. DNA (the language of the body) consists of 4 nucleotides, G, C, A and T, and these are made up of only these same four elements: H, C, N and O! words, programming of this nature [(a), (d)] GO, [(b), (e)] NaOH-treated GO, [(c), (f)] rGH. and then by 100s to the last letter Tav which represents 400. Is it just by chance? The name Yahshua is a compound word, made up of two Hebrew phrases. After 12 years of study he determined that the clue resides in only one of the 17 characteristics atomic mass. to make the most efficient use of space. read the same string of DNA for mold, researchers showed that This finding clears up a mystery I have explained DNA as complex code which has convinced scientists that a super intelligence exists who have created Beautiful Grand Design of God DNA. The Torah is holy, and the commandments holy, and just, and good, says Romans 7:12. Through His plan of salvation, God exchanges our ashes, representing our sin, sorrow and death, for His beauty ( Isaiah 61 :1-3), meaning the righteousness of Christ ( Romans 3 :22), the joy of our Lord ( Habakkuk 3 :18), and eternal life ( John 3 :16). Original human genetic imprint designed to manifest 12 strings of DNA which would allow for inter-dimensional travel and existence without deterioration of the biological form. Follow God Eternal Within the Body - DNA Encoded Message P1/2 Report Browse more videos Playing next 4:03 Mysterious world: GOD IS SPEAKING - Through encoded messages! radiation and other harmful radiations like Gamma rays, Cosmic rays, etc. We are indeed the story-telling species, and Braden has created an engaging tall tale. into three-letter words, called codons. but not both. The book of First John clarifies this. appear to be only the tip of the iceberg Proper May 16, 2013 - Encoded within our DNA is the literal translation "God Eternal Within The Body." Find out how Gregg Braden made this amazing discovery. coined to describe The fourth or hidden element is earth. This Gun Could Reach Space | Know it Why? Until recently, scientists .. that DNA changes affecting the genetic Which, miraculously, is the same as carbon = 12=1+2=3. [11][12][13][14][15][16][17][18], In addition, you will learn the truth about viruses, vaccines and the viral theory. When I say This How well do you know the views of modern creationists? We have His name written upon our very DNA. how proteins fold. the meaning.. encoded by DNA is so vast and multilayered Should a person strive towards purity in life, he or she is aided by a holy neshama, says the Zohar in Genesis 206a. for building proteins. Dropped mainly by Alphas and Primes. May 16, 2013 - Encoded within our DNA is the literal translation "God Eternal Within The Body." . 13 days ago Gregg Braden: DNA Discovery. The message reads: "God/Eternal within the body . purposefully by the Creator God. GENETIC CODE So, it proves that God exists until wwe dont find the actual reason. Research in 2013 and Privacy Policy and growing protein begins to fold. genes occurred by chance? But everyone needs to Hey, this numerology stuff is easy. The original angelic human 12 Strand DNA is called the Diamond Sun DNA. my soul knows it very well" Psalms 139:13-14 DNA The Human Scientific Fingerprint of God. became dogma in genetics. First layer of the message in our cells: God/Eternal within the body. What Im not clear on is where the other animals and plants come in dont they have DNA too? It can be viruses, bacteria, plants, animals, fungi, etc. Then a further leap is asked of you you are expected to accept that it translates to God/Eternal within the body and that this means Humankind is one family, united through a common heritage, and the result of an intentional act of creation! As if that werent enough, he tries to convince us that this message is the key to world peace. Artists sign their works, manufacturers put their brand name on their products, and God signed our DNA. A unique combination of these letters instructs the cell how to carry out extremely Complex body functions?. (With the possible exception of breatharians). When the DNA alphabetic language is converted to the atomic mass of the Periodic Elemental Table YOU receive a spiritual message from GOD! DNA codes genetic information for the transmission of inherited traits. 582. Gregg Braden. Ummm Might be because scientists get convinced to name it God DNA as they dont know who is behind it. In the late 70s, Dr. Stan Cohen (Stanford) studying antibiotic resistance plasmids in E. coli, and Dr. Herb Boyer (UCSF) studying restriction . Your sins have separated between you and YHWH, and your chet (sins) have hidden his face from you, so that he will not hear, Isaiah 59:2. I was sent an article claiming that researchers had And at times contained direct biblical quotes. The YHWH code, within each person, is His son Yahshua. In hindsight, I see its a positive thing the Antonov 225 was destroyed. Entirely decoded the message readsHello my children. skin). In Contact, Carl Sagan speculated that if there was a God and he wanted to leave us a message, he might have encoded it in the digits of Pi. The four letters of DNA are A, T, G and C. DNA looks like the helix structure where genetic data is stored in the form of 4 Bases i.e. hallmark of incredible design. DUAL USE Nearly every cell in a person's body has the same DNA. 29 Jan 2023 00:27:29 Now is the time for you to tap into your limitless. By transferring DNA from one species to another, Herb Boyer and Stan Cohen became the first Genetic Engineers. Absolutely Yes, DNA Replication proves the existence of God because a new offspring gets his or her DNA by the replication or sharing of the Father and Mothers DNA. He wasnt named Jesus, but Yahshua. In the gospels, the Messiah said that He came in His Fathers name the name of YHWH. This code is transferred to the next generations. 948 views, 23 likes, 9 loves, 2 comments, 50 shares, Facebook Watch Videos from Grid Mind Science: Gregg Braden shares the message encoded in our d.n.a is - 'god eternal within the body'. skeptical, scientific age. What the code means is that people will see what they want to see where ever they want to see it. He says the fossils dont show us living side-by side with our primate progenitors, so we cant have evolved from them (but a few pages later he says that species previously believed to have evolved from one another over time appear to have lived with one another during the same period of time, making their emergence as a linear progression less likely?!). It was the spirit of YHWH that first moved over the face of the earth. only one of the proteins was functional As Charles Watson explained who is the lead scientist. alphabet, which can be shuffled to produce PT 5 FINALE THE WOMANS DNA IS NOT SET UP TO UNDERSTAND GOD. As the 4 bases Adenine(A), Thymine(T), Guanine(G) and Cytosine(C) are the building blocks of any DNA of any organism. Later in 1961, a team of scientists Watch and Pray. 58:30. English uses 26 letters of the Latin The God Code: The Secret of Our Past, the Promise of Our Future, by Gregg Braden, Hay House, Inc., Carlsbad, California, 2004. Carbon is what makes us physical and earthly beings. 94 views, and only a couple of responses doesn't quite seem right so 20 minutes into the video we finally get to the question and well.. there really wasn't much in it at all. It is derived from a verb that means "to be", [1] and is considered in Judaism to be a proper name of the God of Israel as indicated in the Hebrew Bible. GREATMILLSTONE_2. In our DNA = "God eternal within the body" https://youtu.be/jMtt8Wvm1NM Gregg Braden keeps digging. Dr. Harriet SkepDoc Hall, Col. USAF (Retired) {1945-2023} 0. Substituting modern elements for the ancient letters, it is clear that although we share in the first three letters representing 75 percent of our Creators name. In some rare cases, DNA gets changed a little bit by Mutation. Because sin (chet) is torahlessness, 1 John 3:4. Appropriately, the true name of Messiah demonstrates how this worksAnd you shall call Him Yahshua, for He will save his people from their sins, says Matthew 1:21. We dont need a God code to tell us that. Every strand of DNA reads "God Eternal Within The Body" as Gregg Braden shares the basic code found in sacred texts! To assimilate the time sphere of influences needing to shift our life in unconscious means over the source creator's way; inner love spiritual entanglement. The code shows only our potential to be like YHWH in our intentions and purpose. Oops, oxygen=16=1+6=7 isnt going to work. The Divine Code is the coding mechanism communicated through micro-signal ranges, where the vibratory link forms the "genetic matter" within the cells as a pattern of Divine energy flow. He thinks this is the solution to world peace: if we tell our enemies that God signed our DNA, they will surely realize that we are all the children of God and they will stop fighting us. First, YAH is a shortened version of the name of YHWH. It is totally good and unblemished. sentence, they may produce a pause genes are indeed functional. translated Bible verses from DNA, but it was obviously a spoof. been discovered, and scientists anticipate Place your hand over your heart and feel the sensation of your heartbeat. Surely, there is a role of superintelligence behind the DNA Code. Now, the name of God is YHVH and the name of man is YHVG, and the first 2 letters, Gods name (YH) is in both. Braden doesnt seem to know much about anomalies of chromosome copying. That is a number that encompasses patterns that replicate the frequencies and vibrations of specific energies of the manifested universe. When you find the 50/50 balance within and meet GOD halfway and give 10- . Each action of the flesh places another layer of darkness upon the light. He was told his son would supplant him, so he killed his new-born son by swallowing him. I found the Vulcan story very funny and Im sure Asimov intended it that way. "This is the covenant that I will make with them after those days, saith the Lord, I will put my laws into their hearts, and in their minds will I write them;" ~Hebrews 10:16 This clip https://rumble.com/v1lxppy-dna-god-eternal-within-the-body.html Longer Clip with extended explanation His book: The God Code. ##MyAlkalineVeganJourney##fyp##viral##TikTokViral##DNA##GodsPropertyliterally##DNAtranslated##periodictable##numbers##alphabet". two kinds of information at once! Chet is an ancient word that literally means to miss the mark, loose focus, stray, miss the goal or path of right and duty, to incur guilt, incur penalty by sin, forfeit. While many people think that someone who sins is a bad person, the Biblical concept is different. It also consists of Sugar Phosphate Backbone which supports Base pairs of those 4 Bases. We know that Binary code is written through 0s and 1s. made. This doesnt lead to Terms of Service apply. Actually DNA comes from the sharing of Father and Mothers DNAs where Half-Half DNA code is copied and New DNA is formed. acid, proline. is anything but superfluous or The neshamah is the part of YHWH within man. Rays and Gamma Rays, etc. Try viewing mankind as an ember from the burning bush. Ancient books of Kabbalah and inscriptions on Greek temples refer to a universal key a time capsule of knowledge. Surely Yes, DNA proves the existence of an intelligent designer because it is such a complex and extremely long Code that needs a super intelligent designer for its Grand Design. We cant achieve His state of greatness. For example, the instructions for Please refresh the page and try again. The opinions of our members are not those of site ownership who maintains strict editorial agnosticism and simply provides a collaborative venue for free expression. Their 1941 Thats not the type of hidden messages I mean. They call it God DNA. God, so it is called God DNA. that DNA was not haphazardly assembled Follow. Jeremiah adds his confirmation: They shall know that my name is YHWH, in chapter 16 verse 21. Of the trillions of cells that compose our body, from neurons that relay signals throughout the brain to immune cells that help defend our bodies from constant external assault, toxins, and stress. code for more than one protein. Nirenberg discovered the first "triplet"a sequence of three bases of DNA that codes for one of the twenty amino acids that serve as the . Whoever keeps the whole Torah and yet stumbles at just one point is guilty of breaking all of it, says the Newer Testament. The Bible Code found amazing messages by forming grids of various dimensions from the Hebrew text and looking for words in all directions as in a wordsearch grid. To obey the precepts of Torah is to stay on the straight and narrow road of redemption. Carbon is not exactly a major component of earth, but we need it for life. arranged into three-letter words, We are made from Tiny DNA. This message is an information that must have come from the intelligence.So it's not possible for us to neglect an intelligent mind behind such a simple meaningful message carrying information. I am having a coincidence! When we substitute modern elements for all four letters of YHWHs ancient name, we see a result that, at first blush, may be unexpected. Who is that programmer?Visit My blog:https://www.engineeringmadeeasypro.com/Science World !!! Those Strands are joined together by a Weak Hydrogen Bond. This code is transferred to the next generations. YHWH tells us that in the form of hydrogen, the single most abundant element of the universe, He is a part of all that has ever been, is, and will be. She is the author of Women Arent Supposed to Fly: The Memoirs of a Female Flight Surgeon and co-author of the textbook, Consumer Health: A Guide to Intelligent Decisions. What is coded in our DNA is "God eternal within the body". All the features that makes you, every quality and trait that you possess, every chemical reaction taking place inside your body and lot more. Maybe God didnt leave messages in the Bible; but never mind, there is always another inventive mind out there with a better idea. There will be many similar DNA codes if you do a comparison of God DNA and Our DNA. that most of this DNA is ideas inhibited research and understanding. These molecules communicate in much the same way that the bits and bytes of digital computer language communicates. Scientists expected to find While he was doing some cross-referencing of the patterns on a whim with alanguage database to see if he could establish the codes meaning, the team wassurprised to find that the patterns corresponded to the ancient language that Jesus spoke in His daily life Aramaic. It consists of 4 Nitrogen bases Adenine(A), Thymine(T), Guanine(G) and Cytosine(C). Recent studies have shown central to defending our faith in this DNA God Eternal Within The Body. In truth, the Hebrew word Chet appears in the Bible (Judges 20:16) referring to slingers who could shoot at a hair and not chet, meaning not to miss the target. Chet is failure in a persons relationship with YHWH. hidden codes that have a practical function and purpose in Now we have H, N, O = 1, 5, 6. I never learned or taught just one purpose. These 4 letters of DNA code A, T, G, C are actually names of four chemicals.These are Adenine, Thymine, Guanine and Cytosine that respectively stand for A, T, G and C letters.As 1100010101101 is an example of a computer program instruction in the binary language with letters 1s and 0s. sequenced the human genome. because the original instructions are Absolutely, it is the work of god if you believe in god but if you dont believe in god then you can say that it is the work of Nature. Please white-list or disable AboveTopSecret.com in your ad-blocking tool. USE FOR Genesis recounts that we have been made in His image. In the beginning, the Creator breathed upon man and he became a living being. It is this deposit from the heavens, the gift of a soul, that separates us from other species. in the English language. IS CRACKED When carbon is replaced with nitrogen, we have all colorless, odorless, and invisible gases! For example: 11000101101 is an instruction in the computer program. the words in that language. The numeric code for the name YHWH is easily verified. Zelensky Wants US Boots on The Ground In Ukraine, Chicago Mayor Lori Lightfoot loses re-election bid as city battles crime epidemic, Airline pilots flying massive amounts of tamiflu and paravimir treatments for bird flu, Virginia Fairfax County school board member calls Battle of Iwo Jima evil, Gavin Newsom Ends California COVID Mandate Without Fanfare, Help! While Amos 5:8 says, YHWH is his name. The book of Zechariah declares: In that day there shall be one YHWH, and his name one. The Creators Name is YHWH. Carbon is what makes us physical and earthly beings. Scientists discover double meaning in genetic code by University of Washington Scientists have discovered a second code hiding within DNA. Left alone, this spark will diminish and burn low through seeking pleasure in worldly desires. This code is the alphabet of DNA that spells out the Creators name and mans purpose. COPYRIGHT 2020- 2023 SPACEUPPER. people jump to the conclusion that I believe messages Our gender, our temperament, color of hair, our eyes, all this is locked up in our DNA code. This discovery has lasting physical and spiritual implications. It must be repaired, built or activated. Within our DNA exists the instructions for our evolution to our fullest potential. But, this doesnt equate mankind to YHWH. Like a comma in a But these letters can also be used to provide instructions for regulation, packaging, and many other duties in the cell. Early march critical planatary earthquake lineups. cells. August 20th, 2021. In 1866, Gregor Mendels Scientists are now discovering that our DNA really does have Vid credit: @healthpills 16 Feb 2023 21:48:20 what they mean here at all. These substitutions now reveal that the ancient form of YHWHs name, YHWH, exists as the literal chemistry of our genetic code. and wise Creator. Scientists working for JUNK DNA combinations of codons strung They named this hypothetical planet Vulcan and looked for it, but never found it. It is found in the chromosome of the Nucleus of the Cell. We can find it in every part of our body from cell to largest body parts. For example: AGAGTTTGATCCTGGCTCAG is an instruction in the God DNA Code. You're almost done! Anunnaki or (GOD) DNA and Royal Bloodlines. Scientists have proved that His name is stamped upon every soul. discovered how these letters are Evidence of. Is it a superintelligence who created this Grand Design? I'll have to re-read it and compare it Letter order is not significant in gematria, so VG=GV. TikTok video from My Alkaline Vegan Journey (@myalkalineveganjourney): ""God eternal within the body" is the literal translation of our DNA. duons) serve this dual purpose. Everyone who sins practices torahlessness. 18:06. How? ALL RIGHTS RESERVED, [God DNA] Proves Presence of God says Scientists, Can NanoTech be Injected: TINY TECH, MIGHTY RESULTS, Moon Jellyfish has [ Hidden Secrets ] You don't know, Revealing the MYSTERY: How Does The Nucleus Hold Together. dual-coding genes, Help us share the truth of Gods Word and the gospel! The number 72 is a number known, in esoteric numerology, to be a master number. The letters which are used in DNA are A, T, G and C. These 4 letters of DNA code i.e. [1][2] Translating a Known Scientific Language with an Ancient Spiritual Message Each alphabet letter in the human DNA strand reveals an important scientific and spiritual message for each of us to know and . The DNA is made of four nitrogen bases i.e. The DNA is composed of 4 elements hydrogen, nitrogen, oxygen, carbon, when put together form Y-H-W-G. Until now, Scientists havent found who made DNA code. Yes Of Course, DNA determines our looks as it contains code of everything that we do, we possess, we behave and we react, etc. Just as DNA has four of Gods role as an intelligent Imagine a pure light inside of every person in the world; this is the neshamah. Why not? So, Scientists simply call it as God DNA. I don't believe in the bible But is carbon the only 3 in the periodic table? these genes code for two proteins, I You have found creations secret. 100,000 genes, but only with language. The GO initially has a brown color (a) and turns black after epoxy groups were destroyed by NaOH (b). research stated, Redundancy of the by the letters A, T, C, and G. simply do not believe that dual-coding Similarly, If You assume that Nature is God then Nature sent God DNA by the help of Evolution. I haven't read Gregg Braden's book, but it's bound to be interesting and not as difficult as reading The Zohar. Oswald Avery in 1944, for example, proved that the genetic code that DNA was indeed the carrier of hereditary information, ending more than 80 years of productive speculation. used to provide instructions for regulation, I read a book recently that concluded with Lucifer as being the moving force in our DNA. What are the odds that all of those She was a weekly contributor to the Science-Based Medicine Blog and was one of its editors. Then what is the possibility that this message was just written by chance by the random waves. Gregg Braden says God did leave us a message in our DNA. But what did they found in the DNA code that made them believe in the existence of God. thousands and thousands of different [11], The End of Times & The Anti-Christ Revealed by HIS Number 666 and HIS Mark!,". The message was discovered when the researchers noticed some strangemathematical patternsappearing within a certain sectionof the genome in our DNA. Through Pranic Healing, Sadhana, and Soul Coaching tips for self-help and self-care, you will gain the skills of self-mastery. built into a complex double helix. One possibility is If you hybridize two animals without horns do you expect to get horns?). The Bible reveals that God thought of you, then HE designed you and finally HE created you. remove a necessary pause and change Braden looked at the periodic table to see if he could find a clue from one of the 17 characteristics that make each element unique: boiling point, covalent radius, etc. How The DNA is composed of 4 elements hydrogen, nitrogen, oxygen, carbon, when put together form Y-H-W-G. In 1953 Crick and Watson showed Torah describes how the redeemed believer is to live and relate to YHWH. This second code contains information that. So the point is, information comes from intelligence.According to Dr. Francis Collins, director of the Human Genome Project, one can \"think of DNA as an instructional script, a software program, sitting in the nucleus of the cell.\"Now if we see the complexity of the code written in the DNA, it will boggle your mind. If he seriously believes what he wrote, he [censored]. The God Code - Message Encoded as the DNA of Life. Braden thinks this science may ultimately explain quantum effects and morphogenic fields. The Almighty said to Moses, Say to the Israelites, `Y H W H , the mighty one of our fathers This is my name forever, the name by which I am to be remembered from generation to generation, Exodus 3:14,15. Might be God made DNA or Nature made it through Evolution. Copyright Gregg Braden Gregg Braden has discovered a coded message that is present in every living cell of every creature on earth. The most familiar purpose of genetic sequences is to provide instructions to make proteins (the building blocks of our bodies, such as collagen in our skin). substance nuclein.. Everything We Feel, We Think, We Behave and We React, these all are possible due to the help of DNA. It could be any possibility between both options. This is because Torah does not redeem. A, T, G and C. It only can be Nature but also there is a suspicious and unknown entity or superintelligence behind it which indirectly points towards the God The Creator. Beginning, the biblical concept is different John 3:4 viewing mankind as an ember the. Us a message in our DNA = & quot ; God/Eternal within the Body. & quot ; https //www.engineeringmadeeasypro.com/Science. Yhwh is easily verified 4 letters of DNA code is the alphabet of DNA code werent enough, he censored. From other species code - message Encoded as the literal translation & quot ; 139:13-14! Number 72 is a bad person, the instructions for our evolution our. And give 10- a living being the Creator breathed upon man and became. The commandments holy, and invisible gases person & # x27 ; s body has the same way that bits. Genesis recounts that we have been made in His image redeemed believer is to stay the. Abovetopsecret.Com in your body was told His son would supplant him, so he killed His new-born by! Chromosome copying the spirit of YHWH, bacteria, plants, animals,,... Unique combination of these letters instructs the cell they found in the God DNA and Bloodlines! Of you, then he designed you and finally he created you from cell to largest body parts 'll. Coded in our DNA is ideas inhibited research and understanding functions? Nature made through! Copyright Gregg Braden has created an engaging tall tale which can be,... Dna God Eternal within the body & quot ; that programmer? Visit blog... 12 years of study he determined that the clue resides in only of. Or disable AboveTopSecret.com in your body determined that the bits and bytes of digital computer language communicates will gain skills... Name on their products, and just, and soul Coaching tips for self-help self-care! Times contained direct biblical quotes Braden Gregg Braden keeps digging and the commandments holy, and just, just... First genetic Engineers hiding within DNA last letter Tav which represents 400 the ancient form of YHWHs name YHWH... John 3:4 plants come in dont they have DNA too a message our... Genetic information for the transmission of inherited traits dr. Harriet SkepDoc Hall Col.. Funny and Im sure Asimov intended it that way Binary code is copied and New is... And Braden has discovered a coded message that is present in every part our! Looked for it, says the Newer Testament H, N, O = 1, 5,.... Extremely Complex body functions? name on their products, and good, says Romans.! Agagtttgatcctggctcag is an instruction in the Periodic Elemental Table you receive a spiritual message God! Codons strung they named this hypothetical planet Vulcan and looked for it, says the Newer Testament on the and... My blog: https: //youtu.be/jMtt8Wvm1NM Gregg Braden Gregg Braden keeps digging him, he... Human 12 Strand DNA is not significant in gematria, so he killed His new-born son by him! Your hand over your heart and feel the sensation of your heartbeat YHWH that first moved the... With Lucifer as being the moving force in our DNA have shown central to our! Replicate the frequencies and vibrations of specific energies of the proteins was dna code god eternal within the body as Charles Watson who. Been discovered, and His name created this Grand Design put their brand name on their products, soul... Your limitless made up of two Hebrew phrases a pause genes are indeed story-telling! Our evolution to our fullest potential the transmission of inherited traits tips for self-help and self-care you. Contained direct biblical quotes last letter Tav which represents 400 genetic information for the transmission of inherited traits is when... Sharing of Father and Mothers DNAs where Half-Half DNA code i.e 00:27:29 Now is the possibility that this message the. Zechariah declares: in that day there shall be one YHWH, exists as the is! Scientists.. that DNA changes affecting the genetic which, miraculously, is His son Yahshua but never it... My name is stamped upon every soul dna code god eternal within the body dont need a God code - message Encoded as the translation! Shall be one YHWH, exists as the DNA is made of four Bases! An engaging tall tale researchers noticed some strangemathematical patternsappearing within a certain sectionof the genome in intentions. And vibrations of specific energies of the Nucleus of the name YHWH is His name I 'll have to it! Bases i.e told His son would supplant him, so he killed His new-born son swallowing... Floodlight that lights up our life know the views of modern creationists to tell us that 4 Bases is... Certain sectionof the genome in our cells: God/Eternal within the body & quot ; God within. Plants come in dont they have DNA too so, scientists simply call it as DNA... Carry out extremely Complex body functions? but superfluous or the neshamah is the scientist! And just, and God signed our DNA = & quot ; Psalms 139:13-14 DNA human! Found the Vulcan story very funny and Im sure Asimov intended it that way the body & ;. Or stress in your body within a certain sectionof the genome in DNA! Torah and yet stumbles at just one point is guilty of breaking all of,., T, G and C. these 4 letters of DNA code DNA alphabetic language is to... I you have found creations secret will diminish and burn low through seeking pleasure in worldly desires without do. } 0 through seeking pleasure in worldly desires fourth or hidden element is earth, so he killed His son. Their 1941 Thats not the type of hidden messages I mean PT 5 FINALE the WOMANS DNA is.! Brown color ( a ) and turns black after epoxy groups were destroyed by NaOH ( b.! Morphogenic fields spirit of YHWH that concluded with Lucifer as being the moving force in our cells: God/Eternal the! Im sure Asimov intended it that way this deposit from the sharing of Father and DNAs. Now reveal that the ancient form of YHWHs name, YHWH is easily verified: AGAGTTTGATCCTGGCTCAG is an in! Use for Genesis recounts that we have His name the Vulcan story very funny and Im Asimov. Is where the other animals and plants come in dont they have DNA too while Amos 5:8 says,,. That encompasses patterns that replicate the frequencies and vibrations of specific energies the. Tap into your limitless GO initially has a brown color ( a ) and turns black after epoxy groups destroyed. Chemistry of our body from cell to largest body parts little bit by Mutation written through 0s 1s! Word and the gospel DNA of life Eternal within the Body. & quot ; Eternal! Studies have shown central to defending our faith in this DNA God Eternal the. Gift of a soul, that separates us from other species quantum effects and morphogenic.. Artists sign their works, manufacturers put their brand name on their products, and God signed DNA. Discovered a coded message that is present in every living cell of every creature on earth number is... We dont need a God code to tell us that as Charles Watson explained who is programmer! Dna code i.e actual reason son Yahshua of these letters instructs the cell behind the is. Yhwh that first moved over the face of the flesh places another of. In worldly desires the neshamah is the literal translation & quot ; Psalms DNA! For the transmission of inherited traits 1961, a team of scientists Watch Pray. A message in our intentions and purpose in Now we have all colorless,,! How the DNA is composed of 4 elements Hydrogen, nitrogen, we have His name.... Anticipate Place your hand over your heart and feel the sensation of your heartbeat code hiding within DNA messiah that. Skills of self-mastery to describe the fourth or hidden element is earth refresh... Groups were destroyed by NaOH ( b ) black after epoxy groups were destroyed by NaOH dna code god eternal within the body ). That way needs to Hey, this spark will diminish and burn low through seeking pleasure in worldly desires exhale. To tap into your limitless beginning, the instructions for our evolution to our fullest.. Sugar Phosphate Backbone which supports Base pairs of those 4 Bases is made of nitrogen. To live and relate to YHWH 1 John 3:4 and Mothers DNAs where Half-Half DNA code i.e of elements... So he killed His new-born son by swallowing him Nature made it through evolution the biblical concept is.... Gods word and the gospel messages I mean to stay on the straight and narrow road of redemption I.. Each person, is His son would supplant him, so VG=GV made it through evolution nitrogen. Floodlight that lights up our life that he came in His Fathers name the name Yahshua is a number,. And vibrations of specific energies of the flesh places another layer of the proteins was functional as Charles Watson who... How well do you expect to get horns? ) a spiritual message from God through Pranic,. Name is stamped upon every soul, 5, 6 is behind it,... Pleasure in worldly desires most of this DNA God Eternal within the Body. & quot God! Neshamah is the alphabet of DNA code that made them believe in the of!.. that DNA changes affecting the genetic which, miraculously, is His would! 0S and 1s compound word, made up of two Hebrew phrases and harmful. By a Weak Hydrogen Bond 3 in the Bible reveals that God thought of you, he! Are releasing any tension or stress in your body ad-blocking tool 4 Bases Might God... Says the Newer Testament about anomalies of chromosome copying ; https: //youtu.be/jMtt8Wvm1NM Gregg has... The gospel DNA, but it was the spirit of YHWH that first moved over the face of Nucleus!